Learn More
Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO114
34.95 EUR valid until 2025-06-30
Use promo code "24108" to get your promotional price.
Description
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 ÎĽM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

Specifications
Sequencing Primer | |
Dry Ice | |
M13 | |
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
Liquid |
M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL) Store at –20°C. |
|
10 ÎĽM | |
10 ÎĽM, 45 ÎĽL | |
Sequencing |
Certificates
A lot number is required to show results for certificates. To find your lot number on previous orders use our order status area.
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.