missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO511
45.00 EUR valid until 2024-12-20
Use promo code "21651" to get your promotional price.
This item is not returnable.
View return policy
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)
Specifications
| Forward Sequencing Primer | |
| Dry Ice | |
| pJET | |
| pJET1.2 | |
| Liquid |
| pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL) Store at –20°C. |
|
| 10 μM | |
| 84 μL | |
| Sequencing |
For Research Use Only. Not for use in diagnostic procedures.