missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10223130

Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Brand:  Thermo Scientific™ SO117

28.77 EUR valid until 2024-12-31
Use promo code "21651" to get your promotional price.

Product Code. 10223130

  • 47.95€ / Each
Estimated Shipment: 06-02-2025
to see stock.
Explore more special offers
Add to basket
This item is not returnable. View return policy

Description

Description

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

TRUSTED_SUSTAINABILITY
Specifications

Specifications

SP6, T3, T7
SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
10 μM
10 μM, 42 μL
Sequencing
Sequencing Primer
Dry Ice
SP6
pTZ19R, pTZ57R, pBluescript II
Liquid
Product Suggestions

Product Suggestions

Videos
SDS
Documents

Documents

Certificates
Special Offers

Special Offers

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.

For Research Use Only. Not for use in diagnostic procedures.