missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Thermo Scientific™ T3 promoter Sequencing Primer, 24-mer
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO120
24.62 EUR valid until 2024-11-30
Use promo code "21651" to get your promotional price.
This item is not returnable.
View return policy
Description
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II
Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated
Specifications
| SP6, T3, T7 | |
| T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL) Store at –20°C. |
|
| 10 μM | |
| 42 μL | |
| Liquid |
| Sequencing Primer | |
| Dry Ice | |
| T3 | |
| Sequencing |
For Research Use Only. Not for use in diagnostic procedures.