missing translation for 'onlineSavingsMsg'
Learn More

Cytiva GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Brand: Cytiva 27-1411-01

View more versions of this product

Product Code. 10784157

This item has been discontinued and is no longer available. View the product for possible alternatives or contact our Technical Support team on +351 21 425 33 50 for assistance
View alternative products »

This item is not returnable. View return policy

Description

Provided ready for immediate use
pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Specifications

For Use With (Equipment)	Glutathione S-transferase (GST) gene fusion system
Primer	pGEX 3′ Sequencing
For Use With (Application)	Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors

Content And Storage	-20°C
Quantity	260 U

Product Suggestions

Cytiva GST Vector Primers for Sequencing

Description

Specifications

Product Suggestions

Documents

Special Offers